EST 1745949 is a singleton


Sequence

>1745949 (1 EST) Length=508 CACACGAACACACACGAAAATAAGTCCCCAACCGCTCCCAACCGCAACCACCCACCAAAAAGTGAGGGCTCAGGAGTGGA AAGGACGAAACAAGCAACGCACACACAAAAAAAAAAAAACTGAATCCCCTCCATCTCCCAATCGCACAATTAACAAAACC ACAGGATAGAAAAAAAACCCACATACATCGTTCATTGGCGGCCCGGCCCACACACGCACATTCTCATCGCGTGCTCCCAG CAGAAGCACACCCGCGGCACAACGCAGCGGGCGCCCACTGGCTCCACTCTCTCCTCCCGCCAACGGGTCGAGGGCAGGGA GTGGAACGCTCCACAGGGACGCTGAACGGTCAATGACACATCCCACGTCGTTAGGCCACAGAGCACATAGGGCACAAACC GGGATGCAGCAACCAATCAAGCAATACCTTAAGATTCAACACGCACAGAAAAGCATCCATTTCTTTCATTTTTCAATCGA CACAGGGGTATATCACGTCTTCTGAGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1745949: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459493216890AI007380TENU0400T.cruzi epimastigote normalized cDNA Library


Date: 16:14:38 on Tue 21 Nov 117.