EST 1745952 is a singleton


Sequence

>1745952 (1 EST) Length=193 AAAAAAAAAAAAAAACAGCAGCAACAACAGCAAAACAAGACCAAAAGAAAAAAGAAAAGAACCAGAAGCCATCATCCATA AGAAAAAACTCTCCCAGTAATTCCTCCTTTTCTCTCTTTCCTTCTCGCTTTTTACATTGGTTCCCATTTACTTCAGCTGC CTCCTGCAGACCAAAGTTTTGAAAAGTCCTCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1745952: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459523216893AI007383TENU0403T.cruzi epimastigote normalized cDNA Library


Date: 23:16:32 on Mon 20 Nov 117.