EST 1745954 is a singleton


Sequence

>1745954 (1 EST) Length=430 CTCGTTCGCGTTGCCCTTTACACCTACACCTTTTCACTACCTTCTCCTCCTACTCTTGGGGCAAAGTCCTGTTCCATCAG CGGCAAAAAGCAAAAAAACAAACACGGTAGGAAAAAACACAGGGGACAACTGTGACAGCAGCCAACAGTGCTGTGAGGAC AGGTGGGGGGCGAACGATCCAACACCACCTGACAATTTGTCAATAAAAAGCCTCCTCTCCTCCCCCCCACACACACAGAG AGAGAGAGAGAGAGGGAAATACAAGTGTGCAGTTATTTGGCTGTTGTTTCAATAATACCCGTGCGCTCCACAAAAAACAA AAAACAAAAAACAAACAAACAAAAAGAATATACCAAAAAGGGTGGGGGGGAAAAAAATAAGTTCATTCGCACTCATGCAT ACACACCGCCACACGTCCATGCATATACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1745954: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459543216895AI007385TENU0405T.cruzi epimastigote normalized cDNA Library


Date: 19:50:50 on Fri 17 Nov 117.