EST 1745959 is a singleton


Sequence

>1745959 (1 EST) Length=455 GGCAATAACCGCAAAATGACGTATTTTTTTTCGAAGTGTGTTCCCTGCACTTCCATTGACGGGTGTCCATCGCACCTCTT CCCTCTCACATTCCCATTGTCATTCTCTTATCGGTAAAAATCAGTAATAAGAAAAAGGACAAAGCAAACAGAAACAAGAC AATTACAATAAAACATGTACCAAACCACAAGAAGAAGCGTTGTGTTCATCCCACCGATTCCCCCAATGAGCTAAAAATAA TAAAATAAAAAAGGTAAATTAAATTTCTTTTCTTTCTTTTTTTTTTTTTTTAAACCTTCTTCTGTGCATATTTGTTTTTC ATTGATTTGCTTTTACTTCAAGACGCTATTCACCCACACAATTCTCTCTCTCTATTTTTCTACGTGTAGGATATAATAAA TTAATAAATAAATATATTTGTTGCCAATTCTCCGCAGCGTCTCTCTCCCTCTCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1745959: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459593216900AI007390TENU0410T.cruzi epimastigote normalized cDNA Library


Date: 22:15:10 on Fri 17 Nov 117.