EST 1745969 is a singleton


Sequence

>1745969 (1 EST) Length=442 CAAAATTTGCACATATGAGCCACTGTTCCGTCAACAAAGAATTAAAAAAAACAAATGCAAACGTAAATATATGTAATCAA GCAGGTACCAAAATGGGATTGGGTGTTCTTCGTTTTCGTCCTACCGCTCCACATGGCCTCAACATGCAACGGCCCCCCCA AATTTTACGCCCTCATATGGCCGTCTGTCGCTGCCGTCCATGTTGAACAACGTAATGTGAATTGGGCTTAGCGCTGAAAG TGGTCGGCTTTTGAGGGAGTGGAGCAAAGTGCGTATGGCCTGCTCGTTTGAAAGTGCTCCCACATCACCAACAGGCACGG GAGCCGCTGAGAGCCGTTTCAAGAACGGCTCCCGGTCCCGTCGGTACGCCAGGCAGTTGCTCTCGGCCAGCTCGTCAAAG GTCATCACCACACCCTTCTGCGCCAAATGTGCGGTGGTCGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1745969: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459693216910AI007400TENU0420T.cruzi epimastigote normalized cDNA Library


Date: 1:57:9 on Sat 18 Nov 117.