EST 1745972 is a singleton


Sequence

>1745972 (1 EST) Length=231 AGGGATCAATCTCCACAGCGAGTCATTTGGTCAAATCTCCTTGTCGTTTTTTAAATAAATAAATAAATAAATAAACAATA ATAAAGAAAGAAAATAACAAAAAAAAAAAAATTAGCAATGGCTTTACCTTACACACAATTTCCCTTATCTTGTAATCCGA TCCAGCTGGAATTATTCACATCGTTAGCTCCAAAATGGCGTTCACGATGTCACCCTTGTTGTTTTTGAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1745972: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459723216913AI007403TENU0423T.cruzi epimastigote normalized cDNA Library


Date: 3:53:12 on Sat 18 Nov 117.