EST 1745973 is a singleton


Sequence

>1745973 (1 EST) Length=242 GGGAAACCACCCGCCCCGCACACACACATATACATATGGAAAAAGCTCCAAAAAGGCCTTCTGAGCGCCCCCTTCACACA ATTTCGCCTACTAATAAAAGGGGATGACCGAAAAAAGTGCCTGAAAAAAAAACGTGCTGCGTAAAACAACGATAAAAATC CAAGTGTGACAGTAAACGTAATCGCCAACGGTAGAAGTAGCCGTATTGGATATTTTCGTTGCGTTACGAGACAAAAAAGT TT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1745973: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459733216914AI007404TENU0424T.cruzi epimastigote normalized cDNA Library


Date: 8:36:11 on Fri 24 Nov 117.