EST 1745976 is a singleton


Sequence

>1745976 (1 EST) Length=425 ACAACAGAAATGATAGTAATAATGCTATTAATTTTTGCGGCGCGTTGTGTCATCGCTTCCCTCCGACTCGTTTGGGAGTT CCGTCGTCTCTACCGGAGAGTCCGGAATCACCCCACGGTCCTTCAACAGACGTTCCACGAACTCTGGGGGATTTGGCGCA TCGTAAAACGGATATGCCCTCAGGCGATAGGAACGCGGATCGACAGGGACGTCTGTACCGATACTGGGGGGTGGGGGAAC GATCGCGTTAAAAGGAACAGCGCGTTCCACCCGAAACTCCATGTGCCACCCCGGAACATCCGCAAAGTCTATTTGCACCG GTCTTGTCGTGGTTTCGCCGTGAAACGTCACGTAACCGTAAGCAGTTCCCTTATTTCCATCGCGATTAAAATCAATGGCG GAAAGGGTGACATACTTGTCGTACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1745976: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459763216917AI007407TENU0427T.cruzi epimastigote normalized cDNA Library


Date: 21:15:14 on Sun 19 Nov 117.