EST 1745979 is a singleton


Sequence

>1745979 (1 EST) Length=336 ATCGCTCCTGACACACACACACACACACAGCGTCTCCCTGAAGCATTCGGCCTCACCTCCTCCTCCTTGCATATCCTCCC TCGCACTGCCGATATGCACACGGAAGTCAGGTGGAAGGGGGAATGAAAAAGAAGGGAAAAAAAAAAAAGGACAACTGACA CACAAAAATAAAAAATAAATAAATAAATAAAGGCAGGCAGAGCCGGACGGCCACAGAAAACAGAGCATGACTGCACAATC AAACACACAGTCCCCTCCCTCTTCTTCACTGCCTTTTCACGTCTCTCTCACAGACGTGACGGCAAGAGCTCCAGCTCACC AATACATGGTGCGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1745979: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459793216920AI007410TENU0430T.cruzi epimastigote normalized cDNA Library


Date: 0:40:21 on Fri 24 Nov 117.