EST 1745985 is a singleton


Sequence

>1745985 (1 EST) Length=447 AAAACACACGCAGACGTCGTCTATTCACAAATCTTCGCATTGCAGCAAATCATACAAAAAAAAAACAAACAAGAACGCCC TCCCTTTCTCCTTCTCCCTCTTTCGCTCATAAAAGACACATACAAATAAAAACAATAATAACAATAAAGCAAAATAGAGA AGGAAAATTTACTTTAAGCCAATACATCGGTAATATTTGACGTACATGAGTTTCCACAGTACCCGCTACTTCCTCCACAA CTAAAAACCCACACCTCGACAGGGTAGGGAGGGGTAGGGGTAGGGGGAAATAATAACAAAATGGAGAGAAAGGAGAAAAT AATAATAAACCCCCCGTCAACTTCCACAACAAACATGGCCTACATGAAAGAAAGAAAGAAAGGGAAAACACAGCCCCAAA ACAAAAAGTATCTTTTCTTCAGTGAATGCAAACATCCTCCCCTCCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1745985: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459853216926AI007416TENU0436T.cruzi epimastigote normalized cDNA Library


Date: 14:31:37 on Tue 21 Nov 117.