EST 1745986 is a singleton


Sequence

>1745986 (1 EST) Length=278 AAAAAAAAGAAAAAAGAAACAAAAGGGTAGGAGTTCAGAAAAACTCCCAAAAATATAAAAAAGGAAAAAAAATTTGATTC GGCAGAACTTTTACTTCATGTGCCGGTTCAGCACAAGACGACCGTGTGTTCTGTATAAATATTACCTGCACCAAGAATAA AAACAGAAATGAAAAAAAGAAAGTAAAACGAAAAAAATGAAATTGTACTGTTCCACCAGCCCACACAACACTCTTCATTT TTATTGCGGCATCCGGCCTTTTCTTCCAATCCTCCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1745986: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459863216927AI007417TENU0437T.cruzi epimastigote normalized cDNA Library


Date: 4:18:25 on Thu 23 Nov 117.