EST 1745990 is a singleton


Sequence

>1745990 (1 EST) Length=404 CTTTTCTTTCTTTCGTGTGTGTGTGTGTGTGTGTATATTATATATTATACAACAAAATATATATTAATATATACTCACAT GTATATATATATATATGTAACAGAAATCATCGGAAAATGATCCAGCTGCAGGTTCACCTACAGCTACCTTGTTACGACTT TTGCTTCCTCTATTGAAGAAATATCGGTGAACTTTCGGTCAAGTGAAGCACTCGACTGTCCGATCACCTGTATTGCACCA TCATCGGAAACAACGACGGGCGGTGTGTACAAATGGCTGGGACGTAATCGGCACAGTTTGATGAGCTGCGCCTACGAGAC ATTCCTCGTTGCGCGACCAATAATTGCAATACTCGGTCCCAAGTGGGTCTACGTGATTCCGGGGGTTTCCCACTCTTTTG ATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1745990: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17459903216931AI007421TENU0441T.cruzi epimastigote normalized cDNA Library


Date: 0:33:7 on Thu 23 Nov 117.