EST 1746000 is a singleton


Sequence

>1746000 (1 EST) Length=388 GCCTCGGTTGTCTATCTCTCTCTCTCTCTCTCTCTCCCACTCATCCCTTCGCTTCGCACCCCAATCGTCACGGGCCTGCT GGCTGCAATAATGACTGACACGTCACGAGAATGGAAATGCGTCTCAATAACACCGCCACAAATAATAACGTCCCCACAAG TTGGCAAACTTACACACAAAAAAAAATTCAATTTCTTTTTCTTTTTTCTTTTTTTTTTTTTTTTTGGGTCCACATCGCTC CAGACCCGTGGCAAGACGTCATTTTCATACTCTGAGGCGTTGCCGCTCAGCAAGCAGGAACGGAATGGGATCGGAACGAA TGCAGATGCGGTTGTCGACGGATGGGATCGAAGTGCGACTGCACATGTGCTGAAGAAACAGAGGGACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1746000: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17460003216941AI007431TENU0451T.cruzi epimastigote normalized cDNA Library


Date: 17:54:46 on Tue 21 Nov 117.