EST 1753340 is a singleton


Sequence

>1753340 (1 EST) Length=377 CTTCAACAAAATTATGCGGTCTTCCTAATTTATGGATTCCAAATTCCGAATCAGGTGGTGACCTACATAGACCACTTGAA CTAAAAGAGCATCAATTACGTTTTGTTTCAGACGATAGTAGTCTACCAAGTGGTGGAAGTGAGTATAAGTACTATTATCT CGCTTCGCATTCTTATTTTATTACCTGCTATTGAATTTTCTAAGGTAGTTTTGTGTGTATCTCAGTAGATGTGTAGGAAG CTATAGAATGCGATTTTGTTNATTCAGAAGTATGATGATGAAAATCGCACTGTACTTGCNAATACCACACCTCTCCAGAT ATTTATCAAACTAGTACTGGTTTATGAATTTAAGTNGAATATTTGTCAAAAAAATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753340: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533403228015AI014183MEEG0306.M1RSchistosoma mansoni, egg stage


Date: 19:11:37 on Sun 19 Nov 117.