EST 1753344 is a singleton


Sequence

>1753344 (1 EST) Length=532 CAGTGACTGACGGAGCCTTCAGCCTACTGTCTTCTACACCTCTCACGCAACTCTCCTTTCACTCAACCGCTCCTCAGTAG CTTTCCCTCCTCCACTGAATCTTCCCCGACTCTTCCTCTGACACAATCTCCTCTTCCCTCAAGAACCTATCATTCCATTC CTTTCTGCAGGGATCTCTCCTGTTGTATTACAATTACTGATTGGGAAGGCTGGAGAGATGGCTCGGCACTTGCTGCTCTT CCAGGACACAGGCTCCATTCCCAGGACCCATTTGGCTGCTCACAGTTGTCTCAAACACCAGTTTCAGGGGTATTCAATGA CCTCTCCTGGCCTTCATGGGCACTAGGCACACAAGTAGTACATATACATATATGTAGGCAAAGCACCCATACATATAAAT TTTTAATTAATCAATTTAAAAGTTATTAAGTACTTATTTTTAAAATACTTATTTCATGTATATGAGTGTCTGTCTTCATG ACATCAGAGGCAGATCAGATCCATTACCGATGGTTGTAAGCACATGTGTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753344: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533443228019AI014187MEEG0313.M1RSchistosoma mansoni, egg stage


Date: 10:45:23 on Sat 18 Nov 117.