EST 1753345 is a singleton


Sequence

>1753345 (1 EST) Length=195 TAAAGTCTTGGCAAATCGTAAGGNAGTGAAACTGGAAGCGGACCGCCTAAGTCTTGGCCCACGTGCTGTGTTGGTTATCG CAGAGGTGTTGTTTAATAATCCCTCTACTATACTGACTGATATAAAGAATACTCCCCATTATTACTCCTTGTTTACTCGA TCGGGTGAAGATCAGAANCGAGCCCAAATTATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753345: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533453228020AI014188MEEG0315.M1RSchistosoma mansoni, egg stage


Date: 23:10:7 on Mon 20 Nov 117.