EST 1753348 is a singleton


Sequence

>1753348 (1 EST) Length=455 CTGGCCATCAGATATATCATGAATGCGAGAGAAACAGGACCTGACAATATAACAGCTGAAGCACAGAAGTCAGATGTACT TTGCTTTGTGTATGTGTGACTGCACTCACAAACACATTTGAATTGATACACACGGTGGGATATCACACAAGCGTTTTTAG TCTTATTTTCCAGAGTGATGTGGCTTCAATTTGTCTTCTTTGTGTTGACTTATATCGCTGTGATTTCCAGTTGTACCGGC TTCAGTTGACCAATTTCACACTGTTCTCCATGAATTAAATTTTAAGGAAACTGAACTTAACATAATTCTCCATGTATCGT TACACGATATTCTTGGATAGATGCACTTGATTGGTTGATCAAATGATTGGTTATGTTGAATATTGATTGAAGTTGGATAT CCGTGNTTAGATTGACGGTATCTGGGTTGACAATAAATTGAATAACTTTAAACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753348: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533483228023AI014191MEEG0318.M1RSchistosoma mansoni, egg stage


Date: 3:46:4 on Sat 18 Nov 117.