EST 1753351 is a singleton


Sequence

>1753351 (1 EST) Length=495 GCGTGATGCTGTTGAGGCTGCAATCGCTTTAGACGACTCATCTTTTCGAAGTCGACAGTTGAAAGTCTTACCTAAACGTA CAAACGTTCCAGGAATGTCCATGACAAATCGTCCCCCTTTTGTGAGAGGTCGCGCGCGCGGCAGAGGGATGTCTATTGGT TTCCGTCCTGCGTATGCTGGACGAATGCGATTCCCACGATATCGGCGACGTGGTAGTTATTACTTTTCTCCCTATTAAAT TGATGGGGCCAATAAAAAAGAAATCGACCACAGAAGAAACTTTCGCAACGCGTCCTTATATTCTACTACGTTGTCCAACT ATTTTGCAGAACTAATAGCTTTGTTGTCCAAATTTTTAGGGTATCTTGGTANCCATTTGTACGATGCCGCATTCTATTTG TCCTGCAATCTAACAAGACACACATACTGTGAAAACTTACATCAATCATCTATTGTAATTGGTGCTATTTTGGTTTCGAC CACCTGGCTTGTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1753351: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533513228026AI014194MEEG0327.M1RSchistosoma mansoni, egg stage


Date: 8:48:0 on Mon 20 Nov 117.