EST 1753352 is a singleton


Sequence

>1753352 (1 EST) Length=192 CTTGCCCATCTGGAGAACTATGATATTTTCCCTAGAAGAAAACTGGACCATTATGGCATACCATGCGCTTATGTTCACTG TGATCCCGCAATGTCACCTTGACCAGCTTTTAAAAGTCAGGCTCTATAATGCAGGTATGGGCATGGGAGCTGTTTGTAAA TCAGGAGTATCTCCTTAGTCCTGGTTGGGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753352: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533523228027AI014195MEEG0328.M1RSchistosoma mansoni, egg stage


Date: 12:9:23 on Fri 17 Nov 117.