EST 1753353 is a singleton


Sequence

>1753353 (1 EST) Length=247 CAAAGAGAAAATGAGGCCCAGAGTGGAGGACATCCTTCTTTAGCGTTCAAGAATGTGAGATACAGTCTTTCTTGCCACAG TTGGGTCTGAGCATTGCAGAGCTAGAACAATTAGATCCATCTTCACAGCTCTTTACTCCTACACCCTTGCCCTAGTAACA ANTCATTCCCTAATCCCCAAAGAGCAGGGACTATTTGTCATGTTGTCCTGCAATTTTTGGGTCCCACCCTGCACTCTGTT CTCATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753353: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533533228028AI014196MEEG0329.M1RSchistosoma mansoni, egg stage


Date: 4:32:27 on Wed 22 Nov 117.