EST 1753356 is a singleton


Sequence

>1753356 (1 EST) Length=386 AGCGGCAAATATATGCAACGTTATTTTCAATGAACGTCTCCCAGAACGTAATGAATATTTTCAACCTGGTCGCATGGCTT ATCGTATTGAACTGGAAGANGATTCAGTAGATTTNGAAGTACCAGCTACAGTGATTCGTAGCAAATCTGATTGTTTGCAA ATTGATGGTCGTGGAACTGGTGCAATAACTACCAATGAAATTGTTATTAATAAACTTACTCAAATATTATCATATTTACG GGCTGGTAAACGACATGCAAAGAAGGCTAAACTCAAAGGACGTGTTGCTGACAAGGTCCGAATTTGATTATGNGGATAAT CGACATCTTGTTCATAAAATAGCTAATACNGCCATATTTGAAGGTATCGGAAACGATTACTTACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1753356: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533563228031AI014199MEEG0333.M1RSchistosoma mansoni, egg stage


Date: 2:48:45 on Thu 23 Nov 117.