EST 1753358 is a singleton


Sequence

>1753358 (1 EST) Length=358 CAACAACAGGTCCACACGCCATTCGTTCCTTCAGGATCCTGGAGCCCACGTGCACCGTTGGTTTGGAATCAGAGTTTTCC AACTCCCCTAGGTGAACTTTCGTGTCCACCAACCCGGTTAAAGCGCCAGACATTCGCTTTTCGTCCTCTCAATTTTGTAA ACAACACCTCCGCCACGTGAAGGCAGTGAGTAGGACTTCCCTGGCAGAGGCTATATATTCGCGTGGCCATGTGAGAGCAT TTCGAGAGGGAGAGCGGACTCTCCCCACTCTCGGCCGTACCATGGCATTTGGAGGCAAAGCAAACAGACAAAGACCTATT GGACTTAAACTGCCGNAACACTCAACTCGAAGTTGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753358: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533583228033AI014201MEEG0337.M1RSchistosoma mansoni, egg stage


Date: 4:29:11 on Fri 24 Nov 117.