EST 1753361 is a singleton


Sequence

>1753361 (1 EST) Length=149 GTTCTATAAATACTGCGTCCGAACGTCAACAGTTAGAATTGTTGAAATTTATACCATCTGTCTGCCTTCTATGCAAACAA ACTAATTTAAAATTGATATGATGTTTTCTATCTTGAGATACGTTTTTTTAAAAAAAATTATACTTGCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753361: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533613228036AI014204MEEG0341.M1RSchistosoma mansoni, egg stage


Date: 4:29:33 on Wed 22 Nov 117.