EST 1753365 is a singleton


Sequence

>1753365 (1 EST) Length=236 GGTCAGCGTACTTTATTATTATTATTGTTAGTAATGCCACTTTTTGAATAAGTCCGTATGTTTTCATAAATTTTTCATTT TATCACTCTAATCAGTGATAATGATTTTGGTGGATAATTTTGAAGAAAGATGAAAATGGTTACTCGTTTGCAGCTGTTTG TTATATGCATTTGTTTTTTTACCAAATATGATTACTACGTAAGATTTCGCCAATAAAGGCTTCGTAAAAATTTCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753365: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533653228040AI014208MEEG0353.M1RSchistosoma mansoni, egg stage


Date: 18:54:42 on Sat 18 Nov 117.