EST 1753366 is a singleton


Sequence

>1753366 (1 EST) Length=301 CTCGTGCGAATTCGGCACGAGTCAGAACTTACTTATTTTTTCAAATGTTTTATTACTTAGAAGAAGTAATTCCTGGCAGA CACAGAGTTCTGGAAATGTGGAAGAAAAGAACTTCGTGTTTTTATANCCAAAGAAGTTAAAGCAATGAGAATTAGAAATT ATTTTGAAGCAGCAAAAGGTCTTCTGGGCCCATTAGAGAACAGCTAATACTGTTACAAGTTTACGAACTACTATGGGGGT TTTACTTACCAAGTAACTGTAACAGCAATGGNCAGTCGGTTCAAAATATTATATCTCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753366: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533663228041AI014209MEEG0356.M1RSchistosoma mansoni, egg stage


Date: 20:58:8 on Sun 19 Nov 117.