EST 1753373 is a singleton


Sequence

>1753373 (1 EST) Length=299 CTCCAGCAATCCCCTCTTTGCTTCGTAAGTCTTCCAGGAGGCCTTGAAAGAAGGACAGAGAGACCACCATATGTGTTTAG ACTCCACCAAAGGGCAGCGTGTGACCTTGCAATACTCCCCAAGCCGTTCTCCCTTCCGGACATAGGAAACGTTTAAGCCC ACCCTATGGGTTTAAAGCAGCCATTAAACTATGGTACCAAATACGTCTCTGCCTGGCTACGTTCTAGTCTGGTTCTCTGC TTGAACCCTCACACATACAAAGGCTGCTTGCCTGAAGGTGTCTGGTGTCCTGTACTCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753373: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533733228048AI014216MEEG0387.M1RSchistosoma mansoni, egg stage


Date: 7:20:55 on Mon 20 Nov 117.