EST 1753379 is a singleton


Sequence

>1753379 (1 EST) Length=282 CGAGTGTGAAAACATCACCCTAAGAGGTGTTGCAAGGGTTGAAGCTGCTTTCTTCAGTAAAACAGAATGAATCATATCCG GGCCAGAAGAAACGTCTTTTCTTATGTGCTGTAGTTTACGGAAAAACAGATCAGCGCTCAGATGCACTTCGGAAAGTCCT GTGGAGTTGCAGAGGAAGCTTTCATCAGTGTAGTTGATGTGGGTCGGTTGAAATGTCCAAGAGTATTGTTCAGCCAAAGG GTTAGTGGCATCCCCATCATTATCGATCGCACCATTAGGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1753379: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533793228054AI014222MEEG0394.M1RSchistosoma mansoni, egg stage


Date: 9:6:56 on Tue 21 Nov 117.