EST 1753380 is a singleton


Sequence

>1753380 (1 EST) Length=279 AGCGAATGAACATCNTAATCGTCCTTTAGCCGTTGACAACTTCAATCGATCACTTGTGCGTATAAGGAAAGTGTTAGACA GTGTTGCAGCTGGAGAACCAACATATGACCATTTAACACAGGCGCAAGTTAATCAGTTGGAAGATATGATAGTACAGTAT GAGACCTGGTTGAACCAGCAAATGANTGCAACAAAATCCTCGACCACAAACTTCAGAATCCTGTAGTCAAAGTTACAGAT AATCATATCTCAACAGCAAGCCCATGGGAATCCAGGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1753380: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533803228055AI014223MEEG0398.M1RSchistosoma mansoni, egg stage


Date: 0:17:13 on Fri 24 Nov 117.