EST 1753383 is a singleton


Sequence

>1753383 (1 EST) Length=465 AAGAAAACCATATTTTAAACCAATAGGAAGATTTGATTCCCAGAGTTGCTGTTTTACATTATTTAAAGCATCCAGTTTTC CATGCAAGGTTAGGAGGGACACAAAGAAACAAAAAAATATCATCCTTATTTATGAAAAANAAAGACTGTTACATGAAACT GCCAGGTTTCCAGGAAATGAAATCCATTAAAAAAAAGATTAAAAGGTGTGGGGCTAGAGGGATGACTCAGTGCTTAAAGC CATTTACTTTTCTTCTATAGGCCCCGAGTTCAATTTTCCAGTCCTCACAAGGCATGGCTTAACAATTATCTGTAGGACTG TGACTCCAGATCCAGGGAATCTGCCACCTTCTTCCTATCATAGACAAATACACTCATATGCACATACCCCCAAATAGACA TTGTGCTACCCAGGTACACATTCACACATGTAATAAAAAATAAATAGATAAAATTTAAGGTAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753383: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533833228058AI014226MEEG0607.M1RSchistosoma mansoni, egg stage


Date: 21:28:33 on Fri 24 Nov 117.