EST 1753387 is a singleton


Sequence

>1753387 (1 EST) Length=277 CTCGTGCGAGAAAGGTTACCTCACCACACTGCAGGAATAATCACTCTGCAAGTGCCAAACCTCTATTGGTGCCTTTCCTG AGCCAGTGTGTGTGTTGGTGGGGGGAGGAGTAGAGTTCTGGCATCAGTCACAGAACTGATCCCTAAATCGGTGTACCCTG GGACAGCCAAACTAATTAGCAAGCCAGGGCTTTGTTTTCTCCAATGGACAGCATGGGCGGGGTTGATTTGCAGTGGTCCA TCTTGGAAGGTTCGGACTTTCACCTTCTGTCTGAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753387: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533873228062AI014230MEEG0611.M1RSchistosoma mansoni, egg stage


Date: 2:7:48 on Wed 22 Nov 117.