EST 1753388 is a singleton


Sequence

>1753388 (1 EST) Length=167 CTCGTGCGAATTCGNGCACGAGAGGATTTCAAGGCGAAAAAGTCCAAAACATCAAAAGGTATCGGCGGTTTAAAACCACC GGAAAACAAAAATGGTACAAAGACCCGGTTAATAAGACGATATTTTCAATACGTAATATCTATCGGCTTTGTAGAAAAGC AAAACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753388: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533883228063AI014231MEEG0613.M1RSchistosoma mansoni, egg stage


Date: 12:51:52 on Sun 19 Nov 117.