EST 1753390 is a singleton


Sequence

>1753390 (1 EST) Length=361 CATTAATTACGTGCCTCATTTTGACCTTTGTAAAAGCTTACCACAATTATGGACTTATAACTGTAGAGTCTGATGATGAA GTTATTGCAGAACGAATTGTTCAGTCATCAAGTATTCTTTTACATATCTATATTTCAACAGTATTTTAATTATTTAAAGG ATATTCACAAATGGTATACTTTAAAATGAAGACATTATGAAAGATACCTTATTTTGATAGTCGAAATCATGAGTCAATTG ACGTTAGATCATCATTGAAAACCTGGAAGCGCTGAACTCATGATCTCAACTATTAACATTTGGCTACGCAAAATACTTTC GGATCCGTTGACCAGAACACTNTCAGAAACAACCTACAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753390: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533903228065AI014233MEEG0616.M1RSchistosoma mansoni, egg stage


Date: 16:23:50 on Mon 20 Nov 117.