EST 1753391 is a singleton


Sequence

>1753391 (1 EST) Length=198 CCTATCAGTCTCGCGTGCGAGCTTTAACCACTAGNACCACTGATCTGGCTTGTATTCGATGGTGTTATTGTTTAACTTTA ACCAATCCACGGTATTATGCGACTATCTTTTATTGTGCTCGCTGAGTACATTCTACACGCTTGACACAGTTTTGTCCCAC TAGTCACGGTTTCTCACGAGAACTCCGGAATTTTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753391: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533913228066AI014234MEEG0617.M1RSchistosoma mansoni, egg stage


Date: 0:13:59 on Sun 19 Nov 117.