EST 1753393 is a singleton


Sequence

>1753393 (1 EST) Length=322 AAATAAGATAAATAAAACAACAAAGTTAAGCACATGCCTGCAAATCCTAGTACCTGAGAGGCCAAGGCAAGAAAACGGCC ACAAATTCAAGACTAGTCTGGGGTGGGTAGAGACAATATTACAAGAGAATGTTTAGTACAATCTGATGTTTTCAGATAAC TTTTTTATTTTGTGTGCATTGGTGTTTTCTCCTCTATTTCCCCTGCTTGCATTATGCCAAACCAATGAAAATAAAAGGAC AGGAAAGGGGACTGTATCTAAGTCCTTGACAATTTCATATGCTACTGAGTTATACCTGTGGGTTAATTTCTACTTGTTGA AG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1753393: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17533933228068AI014236MEEG0620.M1RSchistosoma mansoni, egg stage


Date: 8:13:21 on Wed 22 Nov 117.