EST 1760945 is a singleton


Sequence

>1760945 (1 EST) Length=285 GTGATTTAAAAGGAAACTATTTTCCAAATTTAAAATCATGGTAATTGACTAACTCCGCTCGGAGTCCATCTAGTTTTACT GTTGGTTAAAACCCAGATTAAAAGGAGGATAGTTGGTCATAGGGTTAGAAACCCCATCCTATAAAAAAGAACCTTACTTG GTGGTTGGTCGAATTTTACTTTTTTTATATTCATATTGAGATTAGAACTAAGGACCATCTATTCAAACATCAACTCTTTC TTTGCTATATTAATGAATCCAAATAAACATTAATTTATTGAAAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1760945: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17609453237166AI021754ME0040.R1RSchistosoma mansoni, egg stage


Date: 20:41:32 on Tue 21 Nov 117.