EST 1760956 is a singleton


Sequence

>1760956 (1 EST) Length=197 AGAACTAGTCTCGAGTTTTTTTTTTTTTATTTTTTATTTTTTTTTTTTATTTTTTTTTTTCCTTCTTCTTCTTCTTTTTT TTTTTTGCTGCTATTACTATGTAGGTGTTACTCTTTAAATTATTATTTCCTCAGATGAAATGGTCTGGAGGTTTGTCAGG ACAGTATAAAAAGAAATGATGGAGAAGAGGCCTAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1760956: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17609563237177AI021765ME0037.R1RSchistosoma mansoni, egg stage


Date: 19:0:50 on Sun 19 Nov 117.