EST 1760959 is a singleton


Sequence

>1760959 (1 EST) Length=259 CAAAGCTCCGAAAATTCAGCGTTTAACAACACCTTTGAGATTACAGCGTAAACGCCATAGGCATGCAGTGAAGCGCCAAC GCATAGAAACCCGCAGAAAGGCACAAGAAGAATACGCCAAATTGCTCGCTCAGGCCGAAAACAAGCTCGTGATGAGCGTG CAGACGCACGATCCACGAAGTCACTCTTTACGTGAATCTAAAGGACAACAGATAAAGTGCATCATAAATTGTGTACTAAA ATAATATGTGGATAATTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1760959: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17609593237180AI021768ME0100.R1RSchistosoma mansoni, egg stage


Date: 9:4:48 on Sat 18 Nov 117.