EST 1761024 is a singleton


Sequence

>1761024 (1 EST) Length=379 GAACAGGCGTTAAATGCCACCAAAAAACGCAAACGGAAGGGATATGAGCGGGATGGTATGCTTGTTTGTGCTCAGGTAAC TTTTTTGTTGTTGTTGTTGTTGTTTTTGCTTTTGTGGCAGCGGTATTGGAATTATTCACCCTTTTGTTTTGTCTCCGAGT GTTTTTTTTTTTTTTTTGTGTGTGTGTGTCTACTCACCTTGACAAAGGGGGAGTAATTGGCGTTTTACCCGGATCCATGG TGATGCGAGGGAAAAAGTGGGTAGCGGGGAAATGTGACGGCATATTGCTTCCCATCGTGGTGCGTGTGTAAATTGTCTTT TTAAACTTTTCCCGCCCCTGTCTGAGAGTTGGCTTTGAAGAAAGGAGGAGGGACACTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1761024: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610243237431AI021818TENU0497T. cruzi epimastigote normalized cDNA Library


Date: 5:0:12 on Tue 21 Nov 117.