EST 1761027 is a singleton


Sequence

>1761027 (1 EST) Length=380 GTTAAGATTGATAAAGTGGATGATACATACCCCATTTTCTCTGAAAGAACAGAGATAAGGTACAGGATATTCATCCGAGC CGCTGACCGGATTCCGAATTTGTCCATATGAAAAAAATAAAACGGAGAAAAAGTGGTAGATGTTGTGGCGAACGCGTGCC TCGATGTTTGCTCCGATTTTATTTGTTCCGATAGTCTCTGTCATGAGACGCTGCACTCTTTTCGGATGGAAGACACTTAT TACATACAAAGTGGCAGAATTAAAGGTTTCCCATTCACAAGACCCCACCGCAAGTTTCGGATCAAAAGAGAGCGTGTGAT AGCCAAAAATAACAACAAACACTCACTTTTTCCTGCGCGTCTGTATGTGCGTGTGTGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1761027: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610273237434AI021821TENU0500T. cruzi epimastigote normalized cDNA Library


Date: 9:55:3 on Fri 24 Nov 117.