EST 1761037 is a singleton


Sequence

>1761037 (1 EST) Length=322 GGGTCCCCCCCAAAAAAAGAGGGCAAGGGAGAAAAAAGAACAAACAAGCAATAAACATATGGGAACAATAAAAAGATTCC TCTACAATCATGCCGATCCAAATTTGCTGACGTTGTGTAGACCCGGGACGTACGTGTCAGCGGAAACCAATGTATGTGTG TTCTGTGTCGAGGACCATACAGGAATGGGGCCGGGAAAACGGGTACGCGCCCCACGCACAGGTGGCAGCTCTGCATTGTA AACCTGGTTGGGACAACGTACATGGCGTCGATTGCAGATAGACACATGCGAATGAGGGCCGTAAAAGTGGGGTTTTTGAA TA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1761037: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610373237444AI021831TENU0517T. cruzi epimastigote normalized cDNA Library


Date: 19:13:2 on Fri 24 Nov 117.