EST 1761039 is a singleton


Sequence

>1761039 (1 EST) Length=386 AAAAGAAGTAGCAACTGTTTTCTCCACACACACAGTTTTTTTCTTTTTTATTATTTCTTACACAGCTTCTAATTTTTACT CCTTTACTTTTTGTTGCTGTTCCTTGTTGATTTCTTTTCTCTTTTCTTCTGTTCTCGGTTCGGTTTTTGTTGTTTTTGCC GTTGCTTTGTGTGTGCGCGTGTGTCCTCATGGCGTTATTGTCTTACAATTCGCTTGGAGAATAGAAGTGGTCACAGCACC GTGCTCCACACGTCTCATCCTGGCTTAACGTGGTGAAGGCCCAACGGAAATTTCCCTGCGCCCTCCCCTTCTCCCACCTC CTCCTCGTCACCCCATCGCGTTCCCGCCTGCCAAACGACAGGTCAACTCATGATGATGCATAAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1761039: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610393237446AI021833TENU0520T. cruzi epimastigote normalized cDNA Library


Date: 17:0:51 on Thu 23 Nov 117.