EST 1761057 is a singleton


Sequence

>1761057 (1 EST) Length=399 AAAAAAAAAAAAAACATCCAAAATGTCACATCACTACATGTAGTTAGATATACATACATAAATGTGCGTATGTGTGCGCG AGTGCCTCTTTTTAAAATATGGGAAAAAAAAAGCAGGCGGAAATACACCCCGTTGTAAAAAAGGAATACAAATATATTCA CTTCCATAGATCATACAAACATATAGATATGAATTAAAATCAGAAGTTGCATGCATCACAAGACAAAATTACAACTACAA ATCCAGGGCACGCCCAGACGCATATATTTTTCCTAGATCCCTGTAGTACGACGTGTGTGGTCAGTTCATCATGAACGTGG CCTGGGAAACGGTGGAGGGACAAGCGTCAGAGACTGCAATGGTGTAGAGACAGAGTAATTTGCGGAACTAAAGGACGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1761057: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610573237464AI021851TENU0538T. cruzi epimastigote normalized cDNA Library


Date: 10:41:25 on Tue 21 Nov 117.