EST 1761059 is a singleton


Sequence

>1761059 (1 EST) Length=404 GGAAAAACACGGGACACTTGCTGGAAAGATAAAAACAAAAACAAATTCGTCCTCCATTATGTATTCACTCAAAAACACAC ACACAAAAAAAAAAAAAAGCTGCACGTTGGTGCGCGTGTCTCGCCCGAAGATAACAAAATAAGATACACTCGTTACAGTC GTTTAAACCCCCGGTGCCCACAAATCATTTATATTCCACTGGGACACTCGGCGTGGTTTCGTGCCCCCCATTCCATTGTC TCGTTTATTAGCCGGCGCCGTCGGCGTGGCACACAAAGCCGAGCGCGCCTCTGGTCAAACAAACAAACAAAAAACAAGAA CACTGAGTAGATCCCGCCGTTGTCGGAGGACCAAAAGACGGGGGGAAAATAAAAAAACAAACAAACAAAAACCACGCGAT GATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1761059: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610593237466AI021853TENU0540T. cruzi epimastigote normalized cDNA Library


Date: 12:47:52 on Sun 19 Nov 117.