EST 1761066 is a singleton


Sequence

>1761066 (1 EST) Length=403 GTTTTTTGTGTGTGTTTTTCCTTTTTTTTTTTTTTTTGCTTCCGTGTTTGTTCTGAGCAAACGGAACTCATCAACCGTAA CATTTTATCCCAGTTTTTCGTTTCTTTTCTTCTCCGCAACGCCTGTACTCCATAAAAAAAAAAAAAAAATACTCACCCAC CTATAGACATACACACACATGTACAATGGATACGTGTGTGCATGTCATTGCTACTCGAGAAGGTACATGAAGCAGTAGTG CTGCTTGCAAAGGAAGTAGGCGACCTGAAATCCAAAAATTGGCCCTAAAACCGGAATGCGGTTCACACGCCCCACGACAA AATGTTCGTACACAAACTTCTGCAGCAGTGCCGGGAAAAAGGGGTCGCGCAGGAAGGAGAAGGCGATATTGCGAACTATC TGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1761066: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610663237473AI021860TENU0547T. cruzi epimastigote normalized cDNA Library


Date: 1:39:36 on Sun 19 Nov 117.