EST 1761067 is a singleton


Sequence

>1761067 (1 EST) Length=355 GGGGATCCAAATGAACCGATGCGTGCCTTTTGTTTTTCTGAAGGAAAGTTATCGCAAGGACTTTTGTGTCCGCCTTGCTT CTTTATGGACGTATGTCCCTTTCAACGCGTTGGTGACGCCTCTGCCGATGATGCGGGAATTTTCTCTGCTGCGCCGCTTA GATACGCTGTAATACCGGGCTTTTTTGCGCATCCATCTCCATCGCCATTCAAGCAGACTGCGAAGTCGCCACGGAGAGCG CGTGACGCCGTGTGTAAAGCATCACTGCGGAAACTTGTGAAGAAGGCTTTCGACGCCGCTCGCCACGCTATGGGTGCTGT GGACGATATTCCGAATGACTCGCTGCTAATTGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1761067: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610673237474AI021861TENU0548T. cruzi epimastigote normalized cDNA Library


Date: 2:54:12 on Tue 21 Nov 117.