EST 1761071 is a singleton


Sequence

>1761071 (1 EST) Length=111 AAAGAGAAATTCCGTAGCTGAACGCTTCTCATAAAGTAAATCGGGAAATTAAGAGCTGAATTCTTTCTTCTTTGCTTTCT GATTCTTTTTTCCTTTTCTCGACAATAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1761071: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610713237478AI021865TENU0552T. cruzi epimastigote normalized cDNA Library


Date: 23:52:1 on Fri 17 Nov 117.