EST 1761076 is a singleton


Sequence

>1761076 (1 EST) Length=214 GTTTGGCGATAAGTGCGGACTTCTCATTGTTGTCCCTCTCAAGAGCCTCCATTTCATGCAGGAGGTGCCCCAAATCATCT GAAAGTGGTTTGTACGCACCGTTTTGGGGCACAGGAAAGCTACTCATCCCACCGGTTAGCAAACCTGACAGTTGAACGGA CGGCATTGTTTGTGTGGCCACATCACACCTCTGCATGCCGCTTGTTGGTAAGCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1761076: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610763237483AI021870TENU0557T. cruzi epimastigote normalized cDNA Library


Date: 4:14:20 on Thu 23 Nov 117.