EST 1761077 is a singleton


Sequence

>1761077 (1 EST) Length=391 CAACGAGGCGCAGAAGAAGGAGCATCTGCCGAAGATCGCCGCGGGCCTCATCCGCTGGTGCCAGGGCTATTCCGAGCCCA ATGCCGGCTCCGATCTCGCCTCGCTGCAGACGCGCGCCGAGAGCGACGGCGACGAGTTCGTCATCAACGGCCAGAAGATC TGGACGTCCTACGCGAACTACGCTGACTGGATCTTCTGCCTGGTGCGCACCGATCCGGCCGCGAAGAAGCATGACGGCAT CAGCTTCATCCTGTTCGACATGACCTCGAAGGGCGTGTCGACCAAGCCGATCCTCTTGATCTCCGGCTACTCGCCGTTCT GCGAGACCTTCTTCGACAATGTGCGCGTGCCGAAGTCGCACGTCGTGGGCACCGTCAACCGCGGCTGGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1761077: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610773237484AI021871TENU0558T. cruzi epimastigote normalized cDNA Library


Date: 12:25:30 on Fri 17 Nov 117.