EST 1761085 is a singleton


Sequence

>1761085 (1 EST) Length=408 GAAGACGGTACAAAAGGATGTAGGATGAGGGCGTGCAATGTGCGCCTCCCGTTTTCCCGGTGCGTCCCCACACCACGGCC GTCCCAATACAACGACTCCACAAGAACAACCCTTCACCCCCTTCCTTCCAAGAAGAGAAATGAAGAAAGGAATATATATG TCCCGCCTCAGGGTTTTGATCCCGTTTATTTGCTAGCCGGCTGCTGTGCTGGTATGCGTGCAGCGGAGGCCGTCCCCAAT TTCTTCATCCTCTCCACCTCCTGGACCGCCTCCATGTACGCCCGAGCCTCCTCCTGACGCTTTTTTTCAAGCAGCGTGGA TTGCGCGGTCATGTGCCTCCGCAGTGCAAACAGTTCCTTTTGGCGTTGGTAGCACCTGGGCATGCCGTAAAGTGACCCAA TCGTGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1761085: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17610853237492AI021879TENU0473T. cruzi epimastigote normalized cDNA Library


Date: 9:36:48 on Thu 23 Nov 117.