EST 1765373 is a singleton


Sequence

>1765373 (1 EST) Length=359 CAGATGTTCTTAATTTGGTTCATTTTATTAATAAATTTATTTATTTTTGATAAGTAGTATATATTCATTATACAAAATGA GAATAGTAAGAATGAACTCTAAATATACAATTAAATAATCTAATAAATAGGAATATTAATAAACAAGTAGTAGTAATAAT AATACCCAAAAGGAAAGAATTTGAAAATTGAACAATATTCAATTGATAACAATACTGATAATGTTAATTGAACAATTGTT TATTTGATCGGAATTAAAACAAATAAACAAACAATAAAATCATATTGTTAAAAATTAATGAAATGTATTAATATAAGGGG GGGGCAAAAATTAGGTTGTGCATTGACTATAATAATATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1765373: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17653733241780AI026166MEEG0402.M1FSchistosoma mansoni, egg stage


Date: 15:55:26 on Fri 17 Nov 117.